-
PurposeUsed to package AAV9:cTNT.iCre, which specifically transduce cardiomyocytes and express Cre recombinase. Only works in vivo.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2/9.cTnT.PI.EGFP.RBG
-
Backbone manufacturerPenn Vector Core
- Backbone size w/o insert (bp) 4187
- Total vector size (bp) 7302
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameimproved cre (iCre) recombinase and tdTomato
-
SpeciesSynthetic
-
Insert Size (bp)3115
- Promoter Chicken cardiac troponin T
-
Tag
/ Fusion Protein
- The iCre coding frame and tdTomato coding frame is separated by IRES sequnece
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CCAATAGAAACTGGGCTTGTC
- 3′ sequencing primer CCAGAAGTCAGATGCTCAAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The tdTomato sequence was cloned from the ROSAmT/mG construct. It has a membrane localization peptide. Because it is cloned downstream of IRES, the fluorescence signal is weak.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV.cTNT.iCre was a gift from William Pu (Addgene plasmid # 69916 ; http://n2t.net/addgene:69916 ; RRID:Addgene_69916) -
For your References section:
Pi3kcb links Hippo-YAP and PI3K-AKT signaling pathways to promote cardiomyocyte proliferation and survival. Lin Z, Zhou P, von Gise A, Gu F, Ma Q, Chen J, Guo H, van Gorp PR, Wang DZ, Pu WT. Circ Res. 2015 Jan 2;116(1):35-45. doi: 10.1161/CIRCRESAHA.115.304457. Epub 2014 Sep 23. 10.1161/CIRCRESAHA.115.304457 PubMed 25249570