2C-EGFP-t2a-mCD4
(Plasmid
#216213)
-
PurposeExpresses GFP and mCD4 transmembrane domain under control of the 2C-specific MERVL promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216213 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N2
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCD4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2061
-
MutationCD4 transmembrane domain only
-
Entrez GeneCd4 (a.k.a. L3T4, Ly-4)
- Promoter MERVL
-
Tag
/ Fusion Protein
- GFP-T2A (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer caaagaccccaacgagaagc
- 3′ sequencing primer agatacattgatgagtttggacaaacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2C-EGFP-t2a-mCD4 was a gift from Michelle Percharde (Addgene plasmid # 216213 ; http://n2t.net/addgene:216213 ; RRID:Addgene_216213) -
For your References section:
Nucleolar-based Dux repression is essential for embryonic two-cell stage exit. Xie SQ, Leeke BJ, Whilding C, Wagner RT, Garcia-Llagostera F, Low Y, Chammas P, Cheung NT, Dormann D, McManus MT, Percharde M. Genes Dev. 2022 Mar 1;36(5-6):331-347. doi: 10.1101/gad.349172.121. Epub 2022 Mar 10. 10.1101/gad.349172.121 PubMed 35273077