-
PurposeCMV luciferase reporter - firefly luciferase driven by CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100984 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL4.18
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCMV
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer GACGATAGTCATGCCCCGCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.18 CMV-Luc was a gift from Lee Helman (Addgene plasmid # 100984 ; http://n2t.net/addgene:100984 ; RRID:Addgene_100984) -
For your References section:
Identification of an inhibitor of the EWS-FLI1 oncogenic transcription factor by high-throughput screening. Grohar PJ, Woldemichael GM, Griffin LB, Mendoza A, Chen QR, Yeung C, Currier DG, Davis S, Khanna C, Khan J, McMahon JB, Helman LJ. J Natl Cancer Inst. 2011 Jun 22;103(12):962-78. doi: 10.1093/jnci/djr156. Epub 2011 Jun 8. 10.1093/jnci/djr156 PubMed 21653923